CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
12ORF1ab/nsp4962235621CTCCTGTCCTTCACTCCCCAA

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.1.1.780.66666666666667
B.1.35110.083333333333333
B.1.22110.083333333333333
B.1.16010.083333333333333
B10.083333333333333