CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
6ORF1ab/nsp4985943524AAGTTGCGTAGTGATGTGCTAAAG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
P.1.1220.33333333333333
B.1.1.2810.16666666666667
B.1.110.16666666666667
P.1.1510.16666666666667
P.1.110.16666666666667