CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
6noncoding545434TCCACTAATCTCAGCCTCCCCTGTTCCCGTTGCA

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.99.250.83333333333333
AY.10110.16666666666667