CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
33ORF1ab/nsp4983542721CTAAAGTTGCGTAGTGATGTG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.4470.21212121212121
B.1.617.220.060606060606061
AY.10320.060606060606061
B.1.1.720.060606060606061
B.1.160.1910.03030303030303
B.1.42710.03030303030303
B.1.1.40910.03030303030303
AY.116.110.03030303030303
B.1.110.03030303030303
AY.3910.03030303030303
AY.120.110.03030303030303
B.1.35110.03030303030303
B.1.45610.03030303030303
AY.11010.03030303030303