CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
8ORF1ab/nsp14A2-B1929341820GGTGGCAATGGCAGTGGTGA

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.10340.5
AY.2510.125
AY.11910.125
AY.11710.125
AY.4410.125