CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
8ORF1ab/nsp14A2-B1929341826GGTGGCAATGGCAGTGGTGATGGTGG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.10330.375
AY.2520.25
AY.3910.125
AY.4410.125
AY.310.125