CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
11ORF1ab/nsp37332153874CTACTATCTATGTGGTCTTGGTACGCCTGACTCGTATGCAGCTTGTACCACAAACAAGCCACCATGTGCCATCA

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B60.54545454545455
B.140.36363636363636