CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
7ORF1ab/nsp14A2-B1929341826GGTGGCGATGGCAGTGGTGATGGTGG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.2520.28571428571429
AY.10320.28571428571429
AY.4410.14285714285714
AY.310.14285714285714
AY.11710.14285714285714