CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
14ORF1ab/nsp14A2-B1929341838GGTGGCAATGGCAGTGGTGATGGTGGTTGTGGTGGTGG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.10340.28571428571429
AY.4430.21428571428571
AY.2520.14285714285714
AY.10020.14285714285714
AY.3910.071428571428571
AY.11810.071428571428571
AY.11710.071428571428571