CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
10N2898623631CCAACAACAACAAGGCCAAACGGAACCTTCT

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.4.2.170.7
AY.10120.2
AY.4310.1