CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
7N2953241822AACTCATGCAGACCACACAAGG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.1.1.750.71428571428571
B.1.42910.14285714285714
AY.2510.14285714285714