CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
9ORF1ab/nsp4983442724TCTAAAGTTGCGTAGTGATGTGCT

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.4410.11111111111111
AY.10010.11111111111111
AY.10310.11111111111111
AY.4310.11111111111111