CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
68ORF1ab/nsp4985943530AAAAAGAAACATCATTAGTAAGATAAAATG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.1.1.7100.14705882352941
AY.2570.10294117647059
AY.4350.073529411764706
P.1.1540.058823529411765
AY.330.044117647058824
AY.10330.044117647058824
AY.10030.044117647058824
AY.3420.029411764705882
AY.3320.029411764705882
AY.3920.029411764705882
AY.4420.029411764705882
AY.520.029411764705882
AY.7110.014705882352941
C.37.110.014705882352941
B.1.177.710.014705882352941
AY.11910.014705882352941
B.1.62110.014705882352941
AY.3.110.014705882352941
AY.1410.014705882352941
B.1.52610.014705882352941
B.1.1.52810.014705882352941
B.1.42910.014705882352941
AY.11810.014705882352941
B.1.617.210.014705882352941
Q.410.014705882352941
B.1.62610.014705882352941
AY.9510.014705882352941
B.110.014705882352941
AY.4710.014705882352941
AY.2610.014705882352941
AY.210.014705882352941