CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
9ORF1ab/nsp5A-B1045913532TTGCCTTGGTGATATTGCTGCTATGAGGCCCA

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.7540.44444444444444
AY.10510.11111111111111
AY.9.210.11111111111111
AY.6510.11111111111111
B.110.11111111111111
B.1.617.210.11111111111111