CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
23ORF1ab/nsp3440256140GCACATGCAGAAGAAACACGCACCAAAAACTTGTCCATTA

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.5220.08695652173913
B.1.1.720.08695652173913
B.1.26010.043478260869565