CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
5ORF1ab/nsp3442456928CCAAAAACTTGTCCATTAGCACATGCAG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.7520.4
B.120.4