CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
9ORF1ab/nsp3442456922CCAAAAACTTGTCCATTAGCAC

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.4310.11111111111111
AY.5210.11111111111111
AY.9.210.11111111111111