CoV-GLUE | Insertions | Insertion
Details of the insertion across all lineages:
Count | ORF | Position | CodonNum | Length | Insertion Sequence |
13 | ORF1ab/nsp3 | 4424 | 569 | 31 | CCAAAAACTTGTCCATTAGCACATGCAGAAG |
Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):
Lineage | Count | Proportion |
AY.9.2 | 2 | 0.15384615384615 |
AY.75 | 1 | 0.076923076923077 |
B.1.1 | 1 | 0.076923076923077 |
AY.65 | 1 | 0.076923076923077 |
AY.75.1 | 1 | 0.076923076923077 |
B.1.617.1 | 1 | 0.076923076923077 |
CoV-GLUE is still in development. CoV-GLUE was originally developed as part of COG-UK by Josh Singer using the GLUE framework at the MRC-University of Glasgow Centre for Virus Research (CVR). In 2021 it was redeveloped by Richard Orton to scale to the millions of genome sequences available. We acknowledge support from the MRC (MC_UU_12014/12), WT (220977/Z/20/Z) and UKRI G2P (MR/W005611/1). Please contact Richard Orton with any queries: Richard.Orton@glasgow.ac.uk
|