CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
24ORF1ab/nsp3442456935CCAAAAACTTGTCCATTAGCACATGCAGAAGAAAC

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.7530.125
B.130.125
AY.5220.083333333333333
AY.9.220.083333333333333
AY.10110.041666666666667
B.1.1.710.041666666666667
B.1.617.310.041666666666667
AY.16.110.041666666666667
B.1.617.210.041666666666667