CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
8ORF1ab/nsp3525984728AGGCACAGGTGTTGGAAATACCCACAAG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.1.617.160.75
AY.10210.125
B.1.617.210.125