CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
5ORF1ab/nsp121396217442TACGCCAACTTAGGTGAACGTGACGAAAGCAAGAAAAAGAAG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.1.617.220.4
AY.2010.2
B.1.1.710.2
AY.5910.2