CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
7S2352365427GGGAGCTGAGGGAGCCTTGAATACACC

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.110.14285714285714
AY.7510.14285714285714
AY.9.210.14285714285714
AY.5210.14285714285714