CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
41ORF1ab/nsp3442456939CCAAAAACTTGTCCATTAGCACATGCAGAAGAAACACGC

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.3940.097560975609756
AY.7540.097560975609756
B.1.617.230.073170731707317
AY.5220.048780487804878
AY.75.120.048780487804878
AY.9.220.048780487804878
AY.6510.024390243902439
B.1.617.110.024390243902439
AY.2310.024390243902439
B.1.1.710.024390243902439
B.1.45610.024390243902439
AY.16.110.024390243902439
B.110.024390243902439