CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
36ORF1ab/nsp329026172GTGTTGTGGCAGATGCTGTCGTGTTGTGGCAGATGCTGTCGTGTTGTGGCAGATGCTGTCGTGTTGTGGCAG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
P.1110.30555555555556
AY.2550.13888888888889
AY.2040.11111111111111
AY.10330.083333333333333
AY.10120.055555555555556
AY.2620.055555555555556
AY.99.210.027777777777778
AY.4710.027777777777778
AY.11810.027777777777778
P.1.910.027777777777778
AY.4410.027777777777778
B.1.52610.027777777777778
AY.10010.027777777777778
B.1.1.710.027777777777778