CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
8ORF1ab/nsp3445057720GAGGGTGTTGTTGATGGCAC

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.140.5
B.1.26020.25
B.1.53310.125
B.1.110.125