CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
57ORF1ab/nsp14A2-B1929741929GGTTGTGATGGTGGCAGTTTGTGGTTGTG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B.1.617.2150.26315789473684
B.1.1.7100.17543859649123
B.1.52550.087719298245614
B.1.617.150.087719298245614
AY.6130.052631578947368
B.130.052631578947368
AY.4020.035087719298246
AY.2320.035087719298246
B.1.36.3110.017543859649123
B.1.1.30610.017543859649123
B.1.57610.017543859649123
AY.5610.017543859649123
AY.116.110.017543859649123
B.1.36.2910.017543859649123
B.1.110.017543859649123
B.1.63710.017543859649123
B.1.3610.017543859649123
B.1.35110.017543859649123
AY.10210.017543859649123