CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
78ORF1ab/nsp329026152GTGTTGTGGCAGATGCTGTCGTGTTGTGGCAGATGCTGTCGTGTTGTGGCAG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
AY.4460.076923076923077
AY.4350.064102564102564
B50.064102564102564
AY.11930.038461538461538
AY.10030.038461538461538
AY.10330.038461538461538
AY.12130.038461538461538
AY.3920.025641025641026
B.1.1.720.025641025641026
AY.5.320.025641025641026
AY.320.025641025641026
AY.10220.025641025641026
AY.510.012820512820513
AY.2610.012820512820513
AY.11810.012820512820513
B.1.33510.012820512820513
P.110.012820512820513
B.1.62110.012820512820513
B.1.617.210.012820512820513
B.110.012820512820513
AY.6110.012820512820513
AY.5410.012820512820513
AY.10110.012820512820513
AY.4710.012820512820513