CoV-GLUE | Insertions | Insertion

CoV-GLUE Insertion

Details of the insertion across all lineages:

CountORFPositionCodonNumLengthInsertion Sequence
56ORF1ab/nsp329026132GTGTTGTGGCAGATGCTGTCGTGTTGTGGCAG

Details of the insertion within lineages (Proportion represents the prop of sequences with the deletion that are assigned to that lineage):

LineageCountProportion
B140.25
AY.2540.071428571428571
B.140.071428571428571
B.1.1.740.071428571428571
AY.3930.053571428571429
AY.10320.035714285714286
AY.4620.035714285714286
AY.3.110.017857142857143
B.1.52610.017857142857143
AY.4310.017857142857143
AY.11410.017857142857143
AY.3510.017857142857143
B.1.1.11310.017857142857143
AY.12110.017857142857143
B.1.110.017857142857143
AY.1310.017857142857143