CoV-GLUE | Insertions

CoV-GLUE Insertions

The table below lists all insertions that do not include an N base, and are observed 5 or more times; codonNum equals genome Position if noncoding.

NDetailsCountORFPositionCodonNumLengthInsertion Sequence
1Click104256ORF8282621224AACA
2Click31137ORF8282511182TG
3Click11969noncoding14141C
4Click11211S219901433TAC
5Click10124ORF3a256991023CCC
6Click3445ORF8282141061T
7Click1706S222052149CGGCAGGCT
8Click1347S222042149ACAGATCGA
9Click1225ORF3a256991026CCCCCC
10Click1167ORF8282541192TC
11Click977ORF8282511183CTG
12Click610ORF1ab/nsp486503210HCVTSATHMH
13Click597ORF3a25520439CGGGGCGGC
14Click597ORF1ab/nsp611074341T
15Click584ORF627312371A
16Click491ORF1ab/nsp611074343TTT
17Click452ORF1ab/nsp344245692CC
18Click433ORF7b27879402TG
19Click426ORF1029593112AT
20Click397S218851086TGCTGT
21Click386ORF102956312TA
22Click386ORF1ab/nsp3669613261T
23Click383S220271551G
24Click377noncoding26498264973TTC
25Click343noncoding26493264921T
26Click336ORF82790012TA
27Click331ORF7a27622767CAGCCGG
28Click279ORF1ab/nsp352598479AGGCACAGG
29Click278ORF1ab/nsp3272013CAC
30Click277ORF8282501183CTG
31Click268ORF1ab/nsp15A1-B199831211T
32Click260ORF3a257571223AAT
33Click247S2156923TTT
34Click241noncoding2082081T
35Click235ORF1ab/nsp4985843511AAAAAAGAAAC
36Click217ORF7b27791111T
37Click214noncoding17171C
38Click205ORF1ab/nsp14A2-B192934182GG
39Click202noncoding2372371T
40Click198ORF8282621224AAAC
41Click183ORF1ab/nsp337783531G
42Click178ORF627384614TCTC
43Click176S2359867912GGGGATAGCACT
44Click176ORF82790631T
45Click167S219861417GTGTGTA
46Click166N289872373CAA
47Click162E26441663TTC
48Click156noncoding12121T
49Click154ORF7b27880406ATCTGT
50Click153ORF3a256991022CC
51Click153ORF3a260782293CTT
52Click152ORF1ab/nsp496273581T
53Click150S219951443CTA
54Click147E26452696AACCAA
55Click145ORF8282571206CTAAAC
56Click145noncoding72724AACA
57Click143ORF828028442TA
58Click142ORF6272993319AACTGCGAGCTCCGCGGCG
59Click142ORF627384611C
60Click137ORF1ab/nsp3538889010CVTSATHMHM
61Click134ORF1ab/nsp218133363AAA
62Click130ORF7b278503011CTCAGAGACGG
63Click129ORF8282141062TT
64Click128noncoding10101G
65Click128noncoding22221C
66Click124ORF1ab/nsp216282751A
67Click123ORF1ab/nsp351208011A
68Click122ORF1ab/nsp4985943518AAAAAGAAACATCATTAG
69Click117S2156921T
70Click114ORF1ab/nsp5A-B103861111T
71Click114ORF3a256991021C
72Click114E263152413CACGTTCACCTAA
73Click110noncoding767614AAATATTATATTAG
74Click109noncoding26498264974TTTC
75Click108ORF82790321T
76Click105ORF3a256739410CCTACCTCCC
77Click101noncoding29851298461A
78Click100ORF1ab/nsp218133361A
79Click98ORF1ab/nsp3442456914CCAAAAACTTGTCC
80Click98ORF7a2740858TCCAGCGG
81Click93N290512581A
82Click92noncoding29747297424TATT
83Click91noncoding757510AAACTAAATG
84Click90ORF1ab/nsp611095411T
85Click86ORF7a2740331T
86Click85S237507291G
87Click85ORF7b27880402GT
88Click85ORF8282571204AAAC
89Click83N2828221A
90Click83ORF1ab/nsp611071333TTC
91Click83ORF1ab/nsp3317715315AGAAAACCCTCACCT
92Click83ORF7a27552532TT
93Click82ORF1ab/nsp16211011481T
94Click81ORF82826212212AACAAACAAACA
95Click79S223202533TTC
96Click79ORF828046501A
97Click78noncoding29865298601C
98Click78ORF1ab/nsp329026152GTGTTGTGGCAGATGCTGTCGTGTTGTGGCAGATGCTGTCGTGTTGTGGCAG
99Click77ORF1ab/nsp4985843514AAAAAAGAAACATC
100Click76ORF3a261802639TAGGCCTCC
101Click74ORF1ab/nsp12159658421T
102Click72S231185192GC
103Click72ORF1ab/nsp498594353AAG
104Click70ORF1ab/nsp5A-B1045913511TTGCCTTGGTG
105Click70noncoding28271282663ACT
106Click69ORF1ab/nsp6114271523TTA
107Click69ORF82789911T
108Click68ORF1ab/nsp4985943530AAAAAGAAACATCATTAGTAAGATAAAATG
109Click67ORF1ab/nsp14A2-B192974197GGTTGTG
110Click63ORF8282561203AAA
111Click61ORF3a257971351A
112Click61ORF1ab/nsp340684502AA
113Click60S219791391T
114Click59ORF3a257031043CCT
115Click58ORF828131781T
116Click57ORF1ab/nsp14A2-B1929741929GGTTGTGATGGTGGCAGTTTGTGGTTGTG
117Click56noncoding18181A
118Click56ORF7a27691991T
119Click56ORF1ab/nsp329026132GTGTTGTGGCAGATGCTGTCGTGTTGTGGCAG
120Click56S218891091G
121Click55ORF82790636TTTTTT
122Click53noncoding29724297191A
123Click51ORF1ab/nsp489271251T
124Click51ORF3a257581223AAT
125Click51ORF1ab/nsp101334310714ACATGGAACGCGTA
126Click51ORF1ab/nsp611074342TT
127Click51ORF1ab/nsp349937582CA
128Click50S2327157010CVTSATHMHM
129Click49ORF827988307AAGAAGG
130Click49ORF1ab/nsp3525984711AGGCACAGGTG
131Click49noncoding28272282679TTTCTTTGG
132Click49ORF82790633TTT
133Click48ORF1ab/nsp162155129827ACTTTCGATCTCTTGTAGATCTGTTCT
134Click48ORF1ab/nsp6118122801A
135Click48ORF7a277461183CTT
136Click47ORF7a27552531T
137Click47ORF828047501T
138Click46noncoding26498264975TTTTC
139Click46noncoding29682296774AATC
140Click46ORF627317391T
141Click45noncoding29703296981A
142Click45ORF1ab/nsp14A2-B183681101T
143Click45ORF1ab/nsp211351101A
144Click44ORF1ab/nsp12153926511T
145Click43noncoding29685296801C
146Click43ORF1ab/nsp3696114141T
147Click43ORF7a27541496ATCAGC
148Click43S222032149TCAAGCCTC
149Click43noncoding29860298551T
150Click43noncoding26490264891C
151Click42ORF1ab/nsp4985843516CTAAAGTTGCGTAGTG
152Click42noncoding29755297507AGTGTAC
153Click42noncoding991G
154Click42noncoding76765AAATA
155Click42ORF7a27471267TGGCCAC
156Click42ORF3a257031046CCCCCT
157Click41ORF1ab/nsp3442456939CCAAAAACTTGTCCATTAGCACATGCAGAAGAAACACGC
158Click40noncoding29842298371G
159Click40ORF7a27637811C
160Click40ORF1ab/nsp2226948817GTCCACACTCTCCTAGC
161Click39ORF1ab/nsp5A-B106191891A
162Click39noncoding28281A
163Click39noncoding29291C
164Click39ORF8282641223CGC
165Click38ORF1ab/nsp16211331581A
166Click38ORF82790635TTTTT
167Click38noncoding29681296765TAATC
168Click38ORF1ab/nsp330331051T
169Click38ORF1ab/nsp213491821A
170Click37noncoding29762297571T
171Click37ORF1ab/nsp330731183GAA
172Click37ORF1ab/nsp121345961T
173Click37ORF1ab/nsp5A-B106051841T
174Click37ORF827966235GGAAG
175Click36M26654441T
176Click36ORF7a2740333TTT
177Click36S243589321A
178Click36ORF82790322TT
179Click36noncoding12121C
180Click36ORF1ab/nsp329026172GTGTTGTGGCAGATGCTGTCGTGTTGTGGCAGATGCTGTCGTGTTGTGGCAGATGCTGTCGTGTTGTGGCAG
181Click35ORF1ab/nsp3595710807TGTTCGC
182Click35ORF1ab/nsp489051171T
183Click34ORF6273735712TCTTTCGATCTC
184Click34noncoding29725297202TT
185Click34S231225203CCT
186Click34ORF82790632TT
187Click33S239037801T
188Click33noncoding29825298201T
189Click33ORF1ab/nsp4983542721CTAAAGTTGCGTAGTGATGTG
190Click33ORF627384613CTC
191Click33ORF1ab/nsp611071331T
192Click33ORF7a27623777CAGCCGG
193Click33ORF1ab/nsp21026741T
194Click33noncoding29819298141T
195Click32S223042479CAGGGGAGA
196Click32ORF1ab/nsp496233571T
197Click31noncoding29291T
198Click31noncoding15151G
199Click31noncoding28269282644AAAT
200Click31ORF8282481171T
201Click31noncoding26261C
202Click31S222182191T
203Click31ORF1ab/nsp14A2-B186291971T
204Click31ORF1ab/nsp12138951523TGA
205Click31ORF7a27691993TTT
206Click31ORF1ab/nsp36377122012TGCGTGCGTCGG
207Click30ORF82789912TT
208Click30S225833401T
209Click30ORF7a277411161A
210Click30ORF1ab/nsp3731215311T
211Click29noncoding18181C
212Click29noncoding29836298311T
213Click29S2360468110CVTSATHMHM
214Click29S21770693CTA
215Click29ORF1ab/nsp3846419151A
216Click28noncoding16161G
217Click28ORF1ab/nsp12144143251T
218Click28S223832741T
219Click28ORF1ab/nsp10134031271T
220Click28ORF82790634TTTT
221Click27ORF1ab/nsp351878231T
222Click27noncoding26493264923TTT
223Click26ORF82790323TTT
224Click26ORF1ab/nsp498114191T
225Click26ORF1ab/nsp341484771T
226Click25noncoding30301C
227Click25ORF7a27526441A
228Click25S235836746TCAGAC
229Click25noncoding29828298231T
230Click25ORF1ab/nsp347366733CTT
231Click24E26315243CAC
232Click24ORF1ab/nsp6115211831T
233Click24ORF1ab/nsp611211801T
234Click24ORF3a261122401A
235Click24ORF1ab/nsp219463811T
236Click24noncoding26493264922TT
237Click24noncoding29725297201T
238Click24S231225205GCACC
239Click24ORF1ab/nsp3442456935CCAAAAACTTGTCCATTAGCACATGCAGAAGAAAC
240Click24ORF1ab/nsp4100464981T
241Click24ORF1ab/nsp218963643GGC
242Click23ORF1ab/nsp495023161T
243Click23noncoding29854298491T
244Click23S220091491A
245Click23ORF1ab/nsp16210661361A
246Click23ORF7a27508386CCTGTT
247Click23ORF827931111A
248Click23ORF1ab/nsp350967933CCC
249Click23noncoding74742CG
250Click23ORF1ab/nsp3440256140GCACATGCAGAAGAAACACGCACCAAAAACTTGTCCATTA
251Click22ORF3a25472271T
252Click22ORF1ab/nsp16214562661G
253Click22ORF1ab/nsp1478711A
254Click22N293863701A
255Click22ORF1ab/nsp3837618861A
256Click22S219911435ACTTC
257Click22ORF3a258821633CTT
258Click22ORF1ab/nsp222694884GTCC
259Click22ORF827951181A
260Click22ORF1ab/nsp16215362933ATC
261Click22S231225206GCACCT
262Click22ORF1ab/nsp3586110481T
263Click21noncoding23232CT
264Click21noncoding26261G
265Click21noncoding14141Y
266Click21ORF1ab/nsp711990501A
267Click21S2299547810CVTSATHMHM
268Click21noncoding29811298061A
269Click21ORF1ab/nsp14A2-B192313971T
270Click21ORF7a27673931T
271Click21ORF1ab/nsp3701914341T
272Click21ORF1ab/nsp6113021109AAAGACTGT
273Click21ORF1ab/nsp14A2-B195485036GCACCT
274Click21ORF8280174010GGGTCGCGCC
275Click20ORF627312372AA
276Click20ORF1ab/nsp338323711T
277Click20ORF7a27485311A
278Click20ORF1ab/nsp490261581T
279Click20ORF8282551192CG
280Click20S218751041T
281Click20noncoding1291294TAAT
282Click19ORF1ab/nsp329026112GTGTTGTGGCAG
283Click19N294513913TCT
284Click19ORF8282491172TC
285Click19noncoding26485264842TA
286Click19ORF7b27813181T
287Click19ORF1ab/nsp101334310710ACATGGAACG
288Click19ORF1ab/nsp3724615091T
289Click19ORF1ab/nsp334482431A
290Click19ORF1ab/nsp3788917241T
291Click19ORF1ab/nsp1213541341T
292Click19ORF1ab/nsp343215341T
293Click19ORF7a27481291T
294Click18ORF3a2539723TTT
295Click18ORF3a25472273TTT
296Click18ORF627249163ATT
297Click18ORF1ab/nsp3750415951A
298Click18ORF828134791T
299Click18S228024131A
300Click18noncoding13131C
301Click18ORF8282141063TTT
302Click18noncoding1991991T
303Click18ORF1ab/nsp13166301311T
304Click18noncoding28265282604AAAT
305Click18ORF7b27879403TGT
306Click18ORF1ab/nsp3727315181T
307Click17N293893713AAG
308Click17noncoding20201G
309Click17N288802013AAC
310Click17S21781731A
311Click17ORF1ab/nsp14A2-B192934181G
312Click17N2829251A
313Click17noncoding28273282681T
314Click17noncoding29294CCAG
315Click17ORF1ab/nsp16215392941C
316Click17ORF7a2740332TT
317Click17ORF1ab/nsp13170192611T
318Click17ORF3a25555541T
319Click17ORF8282501181G
320Click17N293783676CATGCC
321Click17noncoding297202971517GGGACAGGGAGAGCTGC
322Click16ORF1ab/nsp221854601T
323Click16noncoding30302TC
324Click16noncoding29709297041A
325Click16ORF1ab/nsp6112881061A
326Click16ORF7a27691992TT
327Click16S239587991T
328Click16N293983741A
329Click16ORF1ab/nsp337223351T
330Click16ORF1ab/nsp339554121A
331Click16noncoding40401T
332Click16ORF8282551191G
333Click16ORF1ab/nsp334122311A
334Click16N287831692TG
335Click16ORF1ab/nsp12141102231A
336Click16noncoding22222CC
337Click16ORF627297321T
338Click16ORF1ab/nsp217012991T
339Click16ORF7a27691994TTTT
340Click16ORF1ab/nsp12144323311A
341Click16noncoding19191A
342Click16ORF7b27882413TTC
343Click15S220001461A
344Click15N294263836CATATT
345Click15ORF1ab/nsp61098131A
346Click15S238357581T
347Click15noncoding12122CT
348Click15ORF1ab/nsp346996604GTTA
349Click15ORF1ab/nsp493142541T
350Click15ORF1ab/nsp14A2-B18215591T
351Click15ORF1ab/nsp4985843518CACCAAGAGTCAGTCTAA
352Click15S21732571T
353Click15ORF1ab/nsp3834118741A
354Click15ORF1ab/nsp3687113848TTGCTATA
355Click15ORF1ab/nsp36871138411TTGCTATAGTA
356Click15N288992071C
357Click14ORF1ab/nsp17401591A
358Click14ORF8282541193TTC
359Click14ORF1ab/nsp3759416251T
360Click14ORF1ab/nsp3442456942CCAAAAACTTGTCCATTAGCACATGCAGAAGAAACACGCACC
361Click14noncoding18181G
362Click14noncoding991C
363Click14ORF7a2740336TTTTTT
364Click14noncoding13131G
365Click14ORF6272993313AGCCGGAGAAGAA
366Click14N2882118110CVTSATHMHM
367Click14noncoding13132TG
368Click14ORF1ab/nsp15A1-B206483431A
369Click14S220621671T
370Click14ORF3a25520436GGGAAC
371Click14noncoding28269282644AAAA
372Click14ORF1ab/nsp3680713631T
373Click14ORF1ab/nsp1316501881T
374Click14ORF1ab/nsp10133431078CACTAGCA
375Click14ORF1ab/nsp340954591T
376Click14ORF3a257031041T
377Click14ORF82825311910HCVTSATHMH
378Click14S24718105210CVTSATHMHM
379Click14noncoding29866298611G
380Click14ORF1ab/nsp14A2-B1929341838GGTGGCAATGGCAGTGGTGATGGTGGTTGTGGTGGTGG
381Click13noncoding19191G
382Click13S243209191A
383Click13ORF1029675386AATTTT
384Click13ORF8282131051T
385Click13ORF1ab/nsp356739851T
386Click13ORF1ab/nsp3631211981A
387Click13noncoding11111G
388Click13noncoding29292CC
389Click13noncoding17171A
390Click13ORF1ab/nsp3688913901T
391Click13N290032421A
392Click13S243839402CT
393Click13ORF102958061T
394Click13ORF1ab/nsp3442456931CCAAAAACTTGTCCATTAGCACATGCAGAAG
395Click13E26430621A
396Click13ORF8282581204AACG
397Click13ORF1ab/nsp14A2-B190113241A
398Click13ORF1ab/nsp341644823CAC
399Click13ORF1ab/nsp12144233281T
400Click13S241068481A
401Click13ORF1ab/nsp16261213TTC
402Click13ORF1ab/nsp48668381T
403Click13ORF828144821A
404Click13E26299181T
405Click12ORF1ab/nsp10133431078ACATGGAA
406Click12ORF1ab/nsp10133501091T
407Click12ORF1ab/nsp10133781181T
408Click12ORF1ab/nsp16851403TTC
409Click12ORF1ab/nsp333452091T
410Click12ORF1ab/nsp488531001T
411Click12noncoding26493264924TTTT
412Click12ORF828046502AA
413Click12ORF1ab/nsp1013225671T
414Click12ORF1ab/nsp331391401G
415Click12ORF1ab/nsp340164331A
416Click12ORF1ab/nsp16215082831A
417Click12noncoding26261T
418Click12ORF3a256991024CCCC
419Click12ORF1ab/nsp1295101A
420Click12N291142791A
421Click12ORF1ab/nsp217223061T
422Click12ORF3a256991025CCCCC
423Click12ORF1ab/nsp15A1-B200911571A
424Click12noncoding23231C
425Click12ORF1ab/nsp4962235621CTCCTGTCCTTCACTCCCCAA
426Click12S223462611A
427Click12ORF1ab/nsp711888161T
428Click12ORF1ab/nsp15A1-B204562799CATTCTGGG
429Click12ORF1ab/nsp14A2-B193434351T
430Click12ORF1ab/nsp334522451T
431Click12N293043421A
432Click12noncoding25251A
433Click12ORF1ab/nsp1315171T
434Click12noncoding297202971513GGGACAGGGAGAG
435Click12ORF3a257011033CCT
436Click12ORF1ab/nsp1443601T
437Click12ORF627312373AAA
438Click11S241458611T
439Click11ORF7a27580621A
440Click11ORF1ab/nsp37332153874CTACTATCTATGTGGTCTTGGTACGCCTGACTCGTATGCAGCTTGTACCACAAACAAGCCACCATGTGCCATCA
441Click11ORF1ab/nsp223175041T
442Click11ORF1ab/nsp14A2-B1929741915GGTTGTGATGGTGGC
443Click11ORF1ab/nsp343035281A
444Click11ORF1ab/nsp214582183AGA
445Click11S224873081A
446Click11ORF1ab/nsp36606129648TAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTTAGCTACCGT
447Click11ORF1ab/nsp3808417891A
448Click11S225723371T
449Click11ORF1ab/nsp3304510918AGATGAGGATGAAGAAGA
450Click11noncoding29710297051G
451Click11S231435271A
452Click11ORF1ab/nsp490051511T
453Click11S239337903CAC
454Click11ORF7a27574602GC
455Click11ORF1ab/nsp5A-B1005921T
456Click11S221201861A
457Click11noncoding29839298341C
458Click11S21701461T
459Click11noncoding17171G
460Click11ORF1ab/nsp12140001871A
461Click11S220031473AAC
462Click11ORF1ab/nsp12151505701T
463Click11noncoding14141T
464Click11noncoding771T
465Click11ORF1ab/nsp32904621A
466Click11ORF1ab/nsp330551123GAA
467Click11ORF1ab/nsp14A2-B194954859ATCATGCAA
468Click11ORF1ab/nsp812296691A
469Click11S21634241C
470Click11N290912711T
471Click11noncoding29858298532CC
472Click11ORF1ab/nsp6114561621T
473Click11ORF102957341T
474Click11E2625741T
475Click11noncoding28282TG
476Click11ORF1ab/nsp221294421A
477Click11ORF1ab/nsp2906341T
478Click11ORF1ab/nsp6113061129ACTGTGTTA
479Click11ORF1ab/nsp218573513TCC
480Click10ORF1ab/nsp1323201T
481Click10ORF8282521182GY
482Click10noncoding30302CC
483Click10ORF1ab/nsp212471481A
484Click10noncoding12122TT
485Click10ORF8282511181G
486Click10ORF1ab/nsp1013077181T
487Click10ORF1ab/nsp5A-B108352611T
488Click10ORF1ab/nsp338173661A
489Click10noncoding29699296941G
490Click10S2156922TT
491Click10noncoding29839298341T
492Click10ORF1ab/nsp3848119211T
493Click10noncoding25252CG
494Click10ORF1ab/nsp5A-B105271581T
495Click10ORF1ab/nsp349217341T
496Click10noncoding29864298597CTATTAA
497Click10noncoding29836298311A
498Click10ORF1ab/nsp3657212859CTAGTCTTA
499Click10ORF1ab/nsp224415461A
500Click10ORF8282491172TG
501Click10ORF627365559AACACCATT
502Click10S219891423TTA
503Click10ORF1029654316TTAACT
504Click10ORF7a27628786CCAGAT
505Click10noncoding28281T
506Click10ORF1ab/nsp6115401901T
507Click10ORF1ab/nsp4985843519GCACCAAGAGTCAGTCTAA
508Click10noncoding28282TT
509Click10noncoding27271T
510Click10ORF1ab/nsp14A2-B185611741A
511Click10ORF7a2740541A
512Click10S219951444ATAA
513Click10noncoding63631A
514Click10ORF1ab/nsp912817442TA
515Click10noncoding20201T
516Click10ORF1ab/nsp3646312481A
517Click10N2898623631CCAACAACAACAAGGCCAAACGGAACCTTCT
518Click10ORF1ab/nsp331881573AAG
519Click10ORF1ab/nsp48742631T
520Click10ORF1ab/nsp131674416984GTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACTAAAAACAGTAAAGTACAAATAGAAGTTG
521Click9ORF627385613CTC
522Click9ORF3a25459223CTA
523Click9S238877751A
524Click9noncoding30302CT
525Click9ORF1ab/nsp5A-B1045913532TTGCCTTGGTGATATTGCTGCTATGAGGCCCA
526Click9ORF1ab/nsp3669613262TT
527Click9ORF1ab/nsp339394071A
528Click9noncoding84842TG
529Click9ORF828048501A
530Click9ORF1ab/nsp331011281A
531Click9noncoding29728297239GTTGTTGGA
532Click9S2220321412TGCCAACAGGAA
533Click9ORF7a27526443ACT
534Click9S2510011791A
535Click9ORF1ab/nsp4985943535AAAAAGAAACATCATTAGTAAGATAAAATGTCAAG
536Click9ORF3a257031043TTT
537Click9ORF1ab/nsp13170592741A
538Click9noncoding29838298331A
539Click9noncoding64641A
540Click9ORF1ab/nsp498584355CTAAA
541Click9S222042149GATCTGGCA
542Click9S2220421412GTACCATGGATA
543Click9ORF1ab/nsp12143272961A
544Click9ORF1ab/nsp214442131A
545Click9ORF1ab/nsp12150615401A
546Click9ORF1ab/nsp14A2-B1929341819GAAATGGGCAACGGGAAAG
547Click9S243799391A
548Click9noncoding771C
549Click9ORF1ab/nsp611069331G
550Click9ORF1ab/nsp4983442724TCTAAAGTTGCGTAGTGATGTGCT
551Click9ORF1ab/nsp3613911401T
552Click9ORF7a276287840CTCTTCTGGAACATACGAGGGCAATTCACCATTTCATCCT
553Click9ORF627277251T
554Click9noncoding11111C
555Click9S242238871T
556Click9ORF1ab/nsp14A2-B193284301T
557Click9S2220421413ACAGATCGAGATC
558Click9ORF7a2740335TTTTT
559Click9noncoding441C
560Click9ORF1ab/nsp14A2-B1929741937GGTTGTGATGGTGGCAGTTTGTGGTTGTGATGGTGGC
561Click9ORF1ab/nsp335752861T
562Click9ORF1ab/nsp6115671991T
563Click9ORF1ab/nsp3442456922CCAAAAACTTGTCCATTAGCAC
564Click9ORF1ab/nsp352248351A
565Click9ORF627263211T
566Click9ORF1ab/nsp611133541T
567Click9ORF7a27528453ATT
568Click9ORF7b27800141T
569Click9ORF82789913TTT
570Click9ORF1ab/nsp353928911T
571Click9ORF1ab/nsp4935026612TCTGTTTTGCTT
572Click9S2157851T
573Click9S236667011A
574Click9ORF1ab/nsp3651312651T
575Click9ORF1ab/nsp3808317881A
576Click9ORF8282391141T
577Click9noncoding29857298521G
578Click9ORF1ab/nsp12146253951T
579Click9noncoding75758AATGTTTG
580Click9ORF1ab/nsp12155597061T
581Click9S220831741T
582Click9S232305561A
583Click9ORF1ab/nsp14A2-B186872161T
584Click9ORF1ab/nsp6116282191T
585Click9ORF1ab/nsp131673716784GAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACTAAAAACAGTAAAGTACAAATA
586Click9ORF1ab/nsp3678113541T
587Click8ORF1ab/nsp3602711031A
588Click8ORF1ab/nsp212141371T
589Click8noncoding16161T
590Click8ORF1ab/nsp13178275301A
591Click8S222042149CACAGTGGA
592Click8ORF1ab/nsp355219341A
593Click8ORF1ab/nsp15A1-B1962211T
594Click8ORF1ab/nsp14A2-B1929741911GTAGTACCGGC
595Click8ORF7a27554543ACG
596Click8ORF3a25437159CGGCGTGAA
597Click8ORF1ab/nsp14A2-B1929341826GGTGGCAATGGCAGTGGTGATGGTGG
598Click8ORF7a277411162AA
599Click8N290162469CGTTTGGTG
600Click8noncoding26506265056AACTTT
601Click8noncoding16161A
602Click8ORF1ab/nsp3805617791T
603Click8ORF1ab/nsp14A2-B194164599GTGAGGTTT
604Click8noncoding30301T
605Click8ORF1ab/nsp3655312781T
606Click8noncoding29800297951C
607Click8ORF8282561204TAAA
608Click8ORF1ab/nsp499124531T
609Click8ORF1029679391T
610Click8ORF3a261812639AACTGTGAG
611Click8noncoding23232CC
612Click8noncoding26500264997GAAAGGG
613Click8S219901431G
614Click8ORF1ab/nsp14A2-B191133581A
615Click8ORF1ab/nsp3696914179GAGGCAGCA
616Click8ORF1ab/nsp492772411T
617Click8ORF7a275515311ACAAGATGGCG
618Click8noncoding62622TC
619Click8S2472110535CTGCC
620Click8ORF1ab/nsp5A-B1045813513TTTGCCTTGGTGA
621Click8ORF1ab/nsp222254746CCTGTG
622Click8ORF1ab/nsp5A-B10301831A
623Click8N294854031A
624Click8S225603331A
625Click8E26416571T
626Click8ORF1ab/nsp495543341T
627Click8ORF1ab/nsp3525984728AGGCACAGGTGTTGGAAATACCCACAAG
628Click8ORF7b2778481T
629Click8ORF1ab/nsp712014581T
630Click8ORF1ab/nsp15A1-B201351721A
631Click8ORF1ab/nsp48606181T
632Click8ORF1ab/nsp5A-B106642041T
633Click8ORF1ab/nsp14A2-B1929341820GGTGGCAATGGCAGTGGTGA
634Click8ORF1ab/nsp3688013871A
635Click8noncoding28270282651A
636Click8ORF7b27816191T
637Click8noncoding29292CT
638Click8noncoding15151A
639Click8ORF7a27584641T
640Click8ORF1ab/nsp812132141T
641Click8ORF1ab/nsp13173463701C
642Click8ORF1ab/nsp3779316921A
643Click8ORF1ab/nsp3445057720GAGGGTGTTGTTGATGGCAC
644Click8ORF1ab/nsp3579210251A
645Click8ORF1ab/nsp8126641911A
646Click8M270481751T
647Click8ORF3a25572609CAGCTGGAG
648Click8ORF1ab/nsp1620908831T
649Click8noncoding29806298011T
650Click8noncoding26482264813TAT
651Click8ORF1ab/nsp32790241T
652Click8ORF1ab/nsp224985651A
653Click8ORF1ab/nsp4100254911A
654Click8noncoding75759GCTTTCTTA
655Click8ORF1ab/nsp354539121A
656Click8ORF1ab/nsp14A2-B193684431T
657Click8ORF828147831T
658Click8ORF1ab/nsp351167991T
659Click8ORF1ab/nsp343765531T
660Click8noncoding78781A
661Click8ORF1ab/nsp1434571A
662Click7ORF1ab/nsp1343261C
663Click7ORF7a277561219AAAACTTTT
664Click7ORF1ab/nsp14A2-B1929341826GGTGGCGATGGCAGTGGTGATGGTGG
665Click7S2352365427GGGAGCTGAGGGAGCCTTGAATACACC
666Click7ORF1ab/nsp13176584741T
667Click7ORF1ab/nsp491051841T
668Click7ORF1ab/nsp13165511051T
669Click7ORF7b27791113TTT
670Click7S243749371T
671Click7noncoding98981A
672Click7noncoding28267282624ACAG
673Click7ORF8282581204AATG
674Click7ORF7a277411163AAA
675Click7ORF1ab/nsp611042241T
676Click7S225023131A
677Click7ORF1ab/nsp12146574061T
678Click7N289692311A
679Click7ORF1ab/nsp352748521A
680Click7ORF1ab/nsp14A2-B192974191G
681Click7ORF3a261252441A
682Click7noncoding22222TC
683Click7S217917610HCVTSATHMH
684Click7N2953241822AACTCATGCAGACCACACAAGG
685Click7S241198521A
686Click7noncoding26496264953TTC
687Click7ORF1ab/nsp3722415021T
688Click7ORF1ab/nsp14A2-B194864823GGT
689Click7S2468410411T
690Click7ORF1ab/nsp6113031119AAGACTGTT
691Click7ORF1ab/nsp3719814933TCA
692Click7ORF1ab/nsp344605811T
693Click7N295344193TGT
694Click7ORF1ab/nsp611179691T
695Click7ORF1ab/nsp3697714201T
696Click7S225463281T
697Click7noncoding29795297901A
698Click7ORF1ab/nsp12158848151G
699Click7ORF1ab/nsp224185381A
700Click7ORF1ab/nsp12155176921T
701Click7noncoding29868298631C
702Click7ORF1ab/nsp12147204271T
703Click7noncoding75751T
704Click7noncoding25252CC
705Click7ORF1ab/nsp3806717831T
706Click7ORF1ab/nsp16212702041T
707Click7ORF8282561204CTGT
708Click7ORF1ab/nsp3688613891A
709Click7ORF1ab/nsp10133851212GT
710Click7ORF1ab/nsp344155661A
711Click7ORF1ab/nsp1213586491A
712Click7noncoding33331A
713Click7ORF7a27637811T
714Click7ORF1ab/nsp347646821T
715Click7ORF1ab/nsp12149485031T
716Click7noncoding16162TG
717Click7noncoding15151T
718Click7ORF1ab/nsp355859561T
719Click7S2497111361T
720Click7noncoding26498264976TTTTTC
721Click7M270971921T
722Click7ORF1ab/nsp344925911A
723Click7S230995121T
724Click7noncoding10101C
725Click7S2208617539TCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAA
726Click7ORF7b278513122GAACTGCAAGATCATAATGAAA
727Click7ORF1ab/nsp4952132310CVTSATHMHM
728Click7ORF1ab/nsp346946591T
729Click7N294413881A
730Click7ORF1ab/nsp332211681A
731Click7ORF1ab/nsp6113061129ACTGTRWWR
732Click7ORF1ab/nsp12161979191T
733Click7ORF1ab/nsp711914241T
734Click7noncoding29866298611T
735Click7ORF1ab/nsp494743071T
736Click7ORF1ab/nsp219313761A
737Click6noncoding30301G
738Click6ORF1ab/nsp12158277961G
739Click6N2897623312TACCCAATAATA
740Click6ORF1ab/nsp3786917179ATACATTGG
741Click6noncoding29721297162CA
742Click6ORF1ab/nsp496753741T
743Click6ORF1ab/nsp13422654GCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCA
744Click6noncoding27271G
745Click6ORF7b27849303AGA
746Click6S233936101T
747Click6S225693361C
748Click6ORF1ab/nsp12138081231A
749Click6ORF1ab/nsp221704559GAGCCAGGG
750Click6ORF1ab/nsp337403413GAC
751Click6ORF1ab/nsp12154086561A
752Click6noncoding10101A
753Click6S21744612GG
754Click6ORF3a258261451T
755Click6noncoding22221T
756Click6ORF1ab/nsp128571T
757Click6ORF1ab/nsp3670713302AG
758Click6ORF1ab/nsp345466091A
759Click6ORF1ab/nsp33004951T
760Click6ORF1ab/nsp3682213681A
761Click6ORF7b27790101T
762Click6S2230424721TTCGAAGGGGTAGGCAGGGTG
763Click6ORF1ab/nsp212911621T
764Click6ORF1ab/nsp48662363GAC
765Click6N289312181T
766Click6noncoding29545295402CA
767Click6ORF1ab/nsp4985943519AAGTTGCGTAGTGATGTGC
768Click6ORF1ab/nsp3809217911A
769Click6ORF627297329AGAGCCGGG
770Click6noncoding2372372TT
771Click6ORF1ab/nsp6115491939GTTCGCGAC
772Click6ORF1ab/nsp15A1-B204862899GAGACTCAT
773Click6ORF1ab/nsp489131203GGC
774Click6noncoding17172GC
775Click6ORF7a27406412ACTCATTTCAGT
776Click6ORF1ab/nsp17321561T
777Click6ORF1ab/nsp12143833141T
778Click6noncoding35352AT
779Click6noncoding29817298121A
780Click6ORF8282551191K
781Click6noncoding545434TCCACTAATCTCAGCCTCCCCTGTTCCCGTTGCA
782Click6ORF1ab/nsp6114171491T
783Click6ORF3a260772283CCT
784Click6noncoding29858298531C
785Click6ORF1ab/nsp338023611A
786Click6ORF627271231T
787Click6S21859993ATA
788Click6ORF1ab/nsp1316475801T
789Click6noncoding14142GC
790Click6S219951441A
791Click6ORF1ab/nsp8126111749TGCAACATG
792Click6ORF3a25672931T
793Click6ORF1ab/nsp6113281191T
794Click6ORF1ab/nsp12158738111T
795Click6S238147511T
796Click6ORF1ab/nsp344235681A
797Click6noncoding29298CTCGGCTG
798Click6ORF1ab/nsp226546171A
799Click6S221041819GGCCTGGCT
800Click6S222052149ACAGATCGA
801Click6ORF7b27883411T
802Click6ORF1ab/nsp12145613742GC
803Click6ORF1029677391T
804Click6S21843946CACTGA
805Click6N2877916716CGACAACAACAACAAC
806Click6ORF1ab/nsp3833518724GAAA
807Click6ORF3a25492336CGATAC
808Click6ORF1ab/nsp221234401T
809Click6noncoding29867298621A
810Click6ORF1ab/nsp14A2-B18138331A
811Click6ORF1ab/nsp6112831041T
812Click6ORF3a25517421T
813Click6S21764673GAC
814Click6ORF102957241A
815Click6ORF1ab/nsp5A-B104271251T
816Click6noncoding29861298561T
817Click6ORF1ab/nsp6112921071T
818Click6ORF1ab/nsp3790517291A
819Click6N2877916713CGACAACAACAAC
820Click6ORF3a25650861T
821Click6ORF1ab/nsp332051623GAT
822Click6ORF7a277521209AGTGTCACT
823Click6S219891421T
824Click6ORF7a2740334TTTT
825Click6noncoding552TC
826Click6ORF1ab/nsp355909575CTAAC
827Click6ORF7a27550522AC
828Click6S2233825922CTGTCTCTTATACACATCTCCG
829Click6noncoding29850298451T
830Click6ORF1ab/nsp12139141581A
831Click6N285991071T
832Click6S219911432AC
833Click6ORF1ab/nsp21095971A
834Click6ORF1ab/nsp339824213ACA
835Click6ORF1ab/nsp6116162151T
836Click6noncoding253922539110ATCAAAGATC
837Click6S21790763GAA
838Click6ORF627267221A
839Click6ORF1ab/nsp4985943524AAGTTGCGTAGTGATGTGCTAAAG
840Click6S220381591G
841Click6S2220621512TAAGCTGAGAAG
842Click6ORF1ab/nsp12157347651T
843Click6S220931776GACCTT
844Click6noncoding29705297005TAGCT
845Click6S223532643TTA
846Click6noncoding29869298645ATTCT
847Click6noncoding29768297633ACC
848Click6ORF1ab/nsp13169072241T
849Click6noncoding12122GC
850Click6ORF3a256991026CCCCCT
851Click6ORF1ab/nsp12158307971A
852Click6ORF1ab/nsp12150195261T
853Click6noncoding29861298561C
854Click6ORF1ab/nsp356469761A
855Click6noncoding15152CG
856Click6ORF1ab/nsp3608711231A
857Click6ORF1ab/nsp14A2-B18255721T
858Click6ORF1ab/nsp16214692701T
859Click6S2230224712TTCTAGTCTTAC
860Click6ORF627383611T
861Click6ORF1ab/nsp497864111T
862Click6noncoding23232CA
863Click5ORF1ab/nsp331411411T
864Click5noncoding29844298391T
865Click5ORF827900113ACTGAATGGTTTC
866Click5ORF1ab/nsp12139941851T
867Click5ORF7a27640821G
868Click5ORF1ab/nsp343615481A
869Click5ORF1ab/nsp6112881062AG
870Click5noncoding30302GC
871Click5noncoding28282AA
872Click5noncoding14141G
873Click5S244359581T
874Click5ORF1ab/nsp333852221A
875Click5ORF1ab/nsp348437081T
876Click5noncoding29858298532AC
877Click5ORF1ab/nsp712008561T
878Click5ORF1ab/nsp342074961A
879Click5ORF1ab/nsp212051341A
880Click5ORF1ab/nsp353188671A
881Click5ORF1ab/nsp5A-B1045913531TTGCCTTGGTGATATTGCTGCTATGAGGCCC
882Click5ORF1ab/nsp14A2-B1929341814GGTGGCAATGGCAG
883Click5ORF1ab/nsp10133821201G
884Click5ORF3a260942341A
885Click5ORF1ab/nsp495753411T
886Click5ORF8282421151T
887Click5ORF7a276931002GA
888Click5ORF1ab/nsp3501076410HCVTSATHMH
889Click5noncoding28282CT
890Click5ORF7a2739611A
891Click5ORF1ab/nsp13170362671A
892Click5ORF7b27876391K
893Click5ORF1ab/nsp3693014041T
894Click5ORF1ab/nsp121396217442TACGCCAACTTAGGTGAACGTGACGAAAGCAAGAAAAAGAAG
895Click5S245599991G
896Click5ORF1ab/nsp223845271A
897Click5ORF1ab/nsp2833101G
898Click5N289742323ACC
899Click5noncoding11115TTTGC
900Click5S244079481A
901Click5ORF1ab/nsp16214212541G
902Click5ORF6272983212CAATTATTTTGG
903Click5S2234626115ACGGTAGTGACAAGT
904Click5ORF1ab/nsp219043671T
905Click5ORF1ab/nsp218963641A
906Click5ORF7a27547511C
907Click5ORF7b27870371A
908Click5ORF1ab/nsp15A1-B199811201T
909Click5ORF1ab/nsp3844719101A
910Click5ORF1ab/nsp221134361T
911Click5noncoding16162GG
912Click5ORF1ab/nsp333262033CTG
913Click5noncoding20202GT
914Click5noncoding29851298461C
915Click5ORF1ab/nsp15A1-B200901571A
916Click5noncoding441T
917Click5ORF3a256911003TGA
918Click5noncoding13132CG
919Click5S2521812191T
920Click5ORF3a25660891T
921Click5noncoding17172TA
922Click5ORF1ab/nsp3595710803ATT
923Click5ORF1ab/nsp496663711T
924Click5S234866411T
925Click5M26713641T
926Click5noncoding14144TGGC
927Click5ORF7a277341142CA
928Click5noncoding27272CT
929Click5ORF1ab/nsp496403629CACTACGCA
930Click5ORF8282351131G
931Click5ORF1ab/nsp226126031T
932Click5ORF6273605312GAAAAGAGGGAA
933Click5noncoding662TT
934Click5ORF6273735712CTTTCGATCTCT
935Click5noncoding37371A
936Click5ORF3a25587651A
937Click5ORF1ab/nsp14A2-B193564391C
938Click5ORF1ab/nsp331651491T
939Click5E26466742TT
940Click5ORF1ab/nsp225395781A
941Click5ORF1ab/nsp13172613421T
942Click5ORF1ab/nsp12149374991A
943Click5ORF1ab/nsp221374441A
944Click5ORF1ab/nsp338243691T
945Click5ORF1ab/nsp12145163591A
946Click5ORF102958791T
947Click5ORF7a277531201T
948Click5ORF1ab/nsp16215342921A
949Click5ORF1ab/nsp3572510021T
950Click5ORF1ab/nsp13167461701A
951Click5ORF1ab/nsp15A1-B19711301T
952Click5ORF1ab/nsp15A1-B1963761T
953Click5ORF8282491171T
954Click5noncoding11115CTTGC
955Click5ORF627330431T
956Click5noncoding29863298581G
957Click5ORF7a27644842AA
958Click5S2532412541A
959Click5ORF1ab/nsp3442456928CCAAAAACTTGTCCATTAGCACATGCAG
960Click5ORF1ab/nsp5A-B1006541A
961Click5S221331902TC
962Click5ORF1ab/nsp15A1-B200641481A
963Click5noncoding13135CTCTC
964Click5ORF1ab/nsp14A2-B195675091T
965Click5S2488511081T
966Click5ORF1ab/nsp12150325311A
967Click5S219951444CTAA
968Click5ORF1ab/nsp15A1-B19652119AATTTTGGG
969Click5noncoding77776ATGTAC
970Click5ORF1ab/nsp12142792801A
971Click5noncoding767610AAATATTATA
972Click5ORF1ab/nsp15A1-B19690231T
973Click5ORF1ab/nsp12151575721A
974Click5ORF3a256991026CCCCTC
975Click5ORF1ab/nsp32872519AAGGTGGAG
976Click5ORF1ab/nsp3601210981A
977Click5ORF1ab/nsp350497774AGAT
978Click5noncoding28265282603AAA
979Click5ORF1ab/nsp912743201A
980Click5S2221921913ATTATGTGGGTTA
981Click5ORF1ab/nsp493392621T
982Click5ORF1ab/nsp1620703151A
983Click5ORF1ab/nsp5A-B10160361T
984Click5ORF1ab/nsp16214262561C
985Click5ORF1ab/nsp354709171T
986Click5ORF1ab/nsp16901423CAA
987Click5ORF1ab/nsp347476761A
988Click5ORF1ab/nsp13168372001A
989Click5ORF1ab/nsp13165591081A
990Click5S230044811T
991Click5S2156924TTTT
992Click5ORF1ab/nsp12155797131A
993Click5N288762003AGT
994Click5ORF1ab/nsp3639612261A
995Click5noncoding26498264977TTTTTTC
996Click5N288802011T